Molecular Biology of the Gene and Reproduction
Worksheet #13 Molecular Biology of the Gene and Reproduction Chemical Structure: For the following, write the full name, what sugar is used for the backbone, whether it is single or double stranded, and what nitrogenous bases it is made of. DNA: RNA: Base Pairs: What nucleotides are base pairs? How are the base pair nucleotides connected to each other? DNA Replication: What are the steps for DNA replication? How many DNA strands are there after replication? Define DNA ligase Define DNA polymerase Transcription and Translation: Where in the cell does transcription occur? Where in the cell does translation occur? Define tRNA Define mRNA What is the product of transcription and what is the product of translation? Using the following image, label transcription with the steps of transcription and the steps of translation. Transcription: Step 1: Step 2: Step 3: Translation: Step 1: Step 2: Step 3: Step 4: Genetic Code: Given the following sequences, translate to amino acid codes. First you must take the DNA and transcribe it to RNA. Next, use the genetic code table to translate RNA to amino acids. TACAAAGGC TACGATACA TACCGTGATTAGGGGAACATTGACACA What does it mean that the genetic code table is redundant? What does it mean that the genetic code table is unambiguous? Reproduction: Define Asexual reproduction: Define Sexual reproduction: What are the gametes for males and females? Define Hermaphroditism: What are the two types of fertilization, and which type of fertilization do human exhibit? Human Reproduction Formation of gametes: Where does spermatogenesis occur? How many sperm cells are produced each meiosis division? Where does oogenesis occur? How many egg cells are produced each meiosis division? What would occur if chromosomes were not segregated correctly during meiosis I vs. meiosis II? What are two genetic disorders from lecture that could result?
Collepals.com Plagiarism Free Papers
Are you looking for custom essay writing service or even dissertation writing services? Just request for our write my paper service, and we'll match you with the best essay writer in your subject! With an exceptional team of professional academic experts in a wide range of subjects, we can guarantee you an unrivaled quality of custom-written papers.
Get ZERO PLAGIARISM, HUMAN WRITTEN ESSAYS
Why Hire Collepals.com writers to do your paper?
Quality- We are experienced and have access to ample research materials.
We write plagiarism Free Content
Confidential- We never share or sell your personal information to third parties.
Support-Chat with us today! We are always waiting to answer all your questions.
