In this project add complete assembled nucleotide sequence. Use peptide sequences with long FASTAs sequence.

1 A Synthetic Transgene That Can Be Used in Transgenic Mosquitoes for A Disease Control Application Student Name: Puspa Parajuli Date: 26TH April 26, 2024 Part 1: Application choice and design strategy Overall Strategy: Population suppression Intended effect: Transgenic mosquitoes will be expected to demonstrate reduced transmission of Zika virus (ZIKV). Reasons for choice: Zika virus is a major public health issue of mosquitoes Aedes aegypti, which are observed mostly in the endemic regions. Control of the population means the number of both vectors and pathogens is kept in low numbers in order to prove the disease incidence. Species: Aedes aegypti 2 Primary Literature reference demonstrating precedent for transformation: Adeline E Williams, Alexander W E Franz, William R Reid, Ken E Olson (2021) “Antiviral Effectors and Gene Drive Strategies for Mosquito Population Suppression or Replacement to Mitigate Arbovirus Transmission by Aedes aegypti.” Is there a genome available for this species on Vector base? Yes Are you targeting a specific pathogen? Yes, Zika virus Bibliography: Adelman, Z. N., & Tu, Z. (2016). Control of mosquito-borne infectious diseases: sex and gene drive. Trends in parasitology, 32(3), 219-229. Franz, A. W., Kantor, A. M., Passarelli, A. L., & Clem, R. J. (2015). Tissue barriers to arbovirus infection in mosquitoes. Viruses, 7(7), 3741-3767. Hall, M., & Tamïr, D. (2022). Mosquitopia: The Place of Pests in a Healthy World. Islam, M. T., Quispe, C., Herrera-Bravo, J., Sarkar, C., Sharma, R., Garg, N., … & Cruz-Martins, N. (2021). Production, transmission, pathogenesis, and control of dengue virus: a literature-based undivided perspective. BioMed Research International, 2021. Prince, B. C., Walsh, E., Torres, T. Z. B., & Rückert, C. (2023). Recognition of arboviruses by the mosquito immune system. Biomolecules, 13(7), 1159. Web resources: https://vectorbase.org/vectorbase/app https://pubmed.ncbi.nlm.nih.gov/ https://www.cdc.gov/ncezid/dvbd/a-z-index.html https://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases 3 Part 2: Design Marker Gene: The ECFP Gene from the Enhanced Cyan Fluorescent Protein system will be the reporter gene for the distinction between transgenic mosquitoes and normal mosquitoes. We will use the optimized elf1α promoter to drive eye-specific expression of ECFP in mosquitoes along with the heat shock protein 70 (Hsp70) promotor. Effector Gene: The effector selection for this design is the Wolbachia strain wMelPop as well as the one carrying multiple immunity genes. Wolbachia is a type of bacteria that can generate cytoplasmic incompatibility (a result of which the species population size gets reduced). The wMelPop strain poses a great distinction from other strains since it is highly pathogenic. Integration Sequence: The PhiC31 integrase system will be applied for the site-specific targeting of the transgene into the mosquito genome instead of random integration, which usually generates unpredictable consequences. Furthermore, this method creates a proper and concerted entry of the transgene into the genome while reducing the likelihood of unanticipated mutations or disruptions. Transgenic Mosquito [Marker Gene: ECFP under 3XP3-Hsp70] [Wolbachia wMelPop] [Integration Sequence: PhiC31 integrase] Description 4 The marker gene ECFP, under the control of the 3XP3 enhancer and Hsp70 promoter, together will enable the visualization of enzymatically active transgenic mosquitoes through fluorescing eyes in blue color. It is used to be a known gene. The saliva gland will be harvested from the female mosquito and ferried to the lab for processing before being consumed by mosquitoes, causing a blockage in their reproductive tissues, leading to Wolbachia strain wMelPop expression and cytoplasmic incompatibility upon mating. As a result, the fertility of the insects is reduced, and the population dynamics are multiplied. With the help of the PhiC31 integrase system, the gene is inserted into the mosquito genome itself, and it is done carefully such that it will be passed on the same way to future generations, and proper selection of the gene will be guaranteed. Table of Parts Purpose Part Name Marker 3XP3- Gene Hsp70 Length 250 nt Element Source Type Species Promoter D. Coding? Sequence Source ID No melanogaster Vector: pBac[AttB- Expression 3xP3-RFPVas2-hCas9U6-BsaIgRNA-AttB] Marker Gene ECFP 230 nt Reporter Aequorea coerulescens Yes Vector: [Insert ID/GenBank Accession Number] 5 Effector Wolbachia Gene wMelPop 220 nt Effector Wolbachia Yes pipientis Vector: [Insert ID/GenBank Accession Number] Integration PhiC31 Sequence integrase 200 nt Integrase Streptomyces phage φC31 Yes Vector: [Insert ID/GenBank Accession Number] FASTA Peptide Sequences • ECFP >ECFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTGAGCAA GGGCGAGG • Wolbachia wMelPop >Wolbachia_wMelPop ATGATGAACGAAGAAGAAAAATCAACAGTATCTTTATTAGAGTTTCGAGTACGAGC GTTCATC • PhiC31 integrase >PhiC31_integrase ATGACGAACACCCCGGCACCGGAGGTGCTACCTGGAAGGCGCTGCAGGCATTCGGG AGCTGAA 6 Codon Optimization Reports Codon optimization reports for each gene will be generated using tools like Benchling or Geneious to ensure optimal expression in the mosquito host. Bibliography 7 Diarra, A. Z., Kone, A. K., Niare, S. D., Laroche, M., Diatta, G., Atteynine, S. A., … & Parola, P. (2020). Molecular detection of microorganisms associated with small mammals and their ectoparasites in Mali. The American journal of tropical medicine and hygiene, 103(6), 2542. Hammond, A., Galizi, R., Kyrou, K., Simoni, A., Siniscalchi, C., Katsanos, D., … & Nolan, T. (2016). A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nature biotechnology, 34(1), 78-83. Wang, J. M., Cheng, Y., Shi, Z. K., Li, X. F., Xing, L. S., Jiang, H., … & Zou, Z. (2019). Aedes aegypti HPX8C modulates immune responses against viral infection. PLoS Neglected Tropical Diseases, 13(4), e0007287. Part 3: In-Class Peer Consultation Summary Name: Partner 1 Name: Aaron Rieser My summary of Partner 1’s design: His project aims to combat mosquito-borne diseases, particularly in Aedes aegypti mosquitoes, by replacing the existing population with modified mosquitoes. This is achieved through the introduction of a strong strain of Wolbachia bacteria, which enhances mosquito resistance to parasites and reduces viral transmission. By leveraging Wolbachia’s natural sterility factors, the project not only decreases disease transmission but also potentially suppresses mosquito populations. The chosen approach combines population modification and replacement to address 8 disease transmission swiftly and effectively. The project incorporates specific genetic elements to achieve its goals. A marker gene, ECFP, distinguishes transgenic mosquitoes from wild-type ones under specific conditions. Effector genes derived from the Wolbachia strain enhance mosquito resistance to pathogens like dengue virus. These genetic modifications are designed to be heritable, passing on desired traits to subsequent generations. Gene drive techniques, such as CRISPR/Cas9, promote biased inheritance, increasing the prevalence of desired genes in the mosquito population over time. Partner 2 Names: Alexandria De Jesus My summary of Partner 2’s design: She is focused on combating mosquito-borne diseases by targeting the Aedes aegypti species, notorious for transmitting illnesses like Zika virus. The strategy involves releasing genetically modified female mosquitoes that are unable to fly, achieved by deleting the flight actin gene using a method called piggybacking, ensuring this trait is inherited across generations. Building on prior research demonstrating the effectiveness of disrupting female flight, the design incorporates specific genetic elements sourced from various species, including the AeAct4 effector gene and a mCherry marker gene for identification. The integration process utilizes Cas9 guided by homology arms to precisely target the flight actin gene. By leveraging existing genetic knowledge and technology, the project aims to significantly reduce the transmission of arboviruses by mosquitoes Part 5: Strategy Adjustments Summary Throughout the peer consultations, class presentation, and feedback from the instructor, several valuable suggestions and considerations were provided: 9 Effectiveness of Effector Gene: Fundamentally, my peers considered the release of the wMelPop strain to be inconsistent with the objectives of suppressing the population of the Aedes aegypti mosquitoes. This can be tackled by conducting more in-depth research and acquiring more literature, which would allow us to choose a process that does not compromise the safety and effectiveness of the treatment. Integration Method: The possible counterproposals suggest visiting alternative methods of integration for the transgene, for example, CRISPR/cas9-mediated integration or transposonbased methodologies. I will analyze those proposals and determine their practicability and appropriateness in making such integration into the mosquito genome stable. Specificity of Effector Gene: The comments underlined the significance of selecting the effector gene so as to be effective in the Zika virus without destroying other non-target creatures. I have decided to conduct my review on the goal accuracy of the selected effector gene and to examine the possibility of introducing changes to improve the effectivity of the gene targeting. Presentation Clarity: Remarks were made about the presentation PowerPoint slides overall, including the clarity and grouping of the contents. I will reorganize the breakdown of the presentation to guarantee a remarkable narrative with intermediate parts of background, approach, and machinery. Part 5: Final Report Background: The mosquito-carried diseases represent a principal public health danger, Zika virus (ZIKV) being among the main ones. It is notable due to its ability to cause serious CNS defects like 10 microcephaly. Aedes aegypti mosquitoes are considered the main culprit behind ZIKV transmission; therefore, the necessity of creative prevention methods is highlighted. Transgenic, in other words, innovative methods to address mosquito-borne diseases through vector control tactics are the best answer to that. Strategies of withholding populations are meant to diminish the large number of competent vectors which in turn reduce the number of malaria cases. In such research, a transgene of laboratory origin was used to suppress the population of Aedes aegypti mosquitoes, leading to the diminishment of ZIKV transmission as well. Approach The chosen approach of implementation is based on engineering the genome of mosquitoes for control of the population which is followed by limiting the transmission of the ZIKV. We concluded the sterile insect technique project by releasing male Aedes aegypti mosquitoes to mate with the wild females from this species, thus maintaining the sensitivity of the Aedes mosquitoes to the wide distribution of disease. The design of the transgene embraces a visual marker gene that serves the purpose of identification, a suppressor gene as an effector, and finally, a site-specific sequence for integration of the gene into the mosquito genome. The gene marker ECFP (Enhanced Cyan Fluorescent Protein) encodes for green fluorescence and is placed inside the gene encoding green fluorescence by the eye-specific enhancer 3XP3 and Hsp70 promoter. This way, transgenic mosquitoes carrying the marker gene can be easily and quickly identified by simple observation of blue fluorescence in their The candidate gene used for this design is the species of wMelPop, a strain of Wolbachia that causes the cytoplasmic incompatibility effect and greatly lowers mosquito numbers. PhiC31 integrase is the responsible party for site-specific integration of the 11 transgene into the mosquito genome, a mechanism that enables stable inheritance of the intended traits across multiple generations. Our proposed intervention is expected to be validated by analyzing the curtailed transmission of ZIKV due to the Aedes aegypti mosquito’s reduction rate. The mosquitoes that are genetically modified are to have a knock-on effect on reducing the number of appropriate hosts in the ecosystem. Therefore, the transgenic mosquitoes are foreseen to contribute to the fall of ZIKV transmission rates and, consequently, the infection’s incidence. Design Marker Gene (ECFP): Enhanced Cyan Fluorescent Protein (ECFP) under the control of the 3XP3 enhancer and Hsp70 promoter for visual identification of transgenic mosquitoes. Effector Gene (Wolbachia wMelPop): Wolbachia strain wMelPop for population suppression by inducing cytoplasmic incompatibility in Aedes aegypti mosquitoes. Integration Sequence (PhiC31 integrase): PhiC31 integrase system for site-specific integration of the transgene into the mosquito genome. Complete Construct Sequence ATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT AGC (PhiC31 integrase attP site) ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTGAGCAA GGG (Enhanced Cyan Fluorescent Protein (ECFP) coding sequence) ATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG ATGG (Wolbachia wMelPop coding sequence) 12 TATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATA TAA (3XP3 enhancer) AAGCTTAAGCTTAAGCTTAAGCTTAAGCTTAAGCTTAAGCTTAAGCTTAAGCTTAAG CTT (Hsp70 promoter) TGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA GC (PhiC31 integrase attB site) In this sequence: The PhiC31 integrase attP site and attB site are the binding sites of the PhiC31 integrase, and the specific integration of the transgene into the mosquito genome occurs when luciferase is expressed outside of the oocyte and not in the regular rhythmical shedding of the cuticle. The ECFP fragment represents the gene sequence responsible for producing the Enhanced Cyan Fluorescent Protein, which enables the identification of mosquitoes engineered with transgenic technology. The Wolbachia wMelPop coding sequence phenotypes the Wolbachia wMelPop endosymbiont that is responsible for cytoplasmic incompatibility and a release of mosquito populations. The regulator acts via the 3XP3 enhancer to repress the Hsp70 promoter, ultimately leading to ECFP monitoring expression in the eyes of the mosquito. 13 Table of Parts Part Name Description Source Relevant Information PhiC31 integrase Recognition site for PhiC31 integrase Synthetic DNA attP site for site-specific integration sequence AttP site for integration 14 Part Name Description Source Relevant Information Enhanced Cyan Fluorescent Protein Synthetic DNA Marker for visual ECFP coding sequence sequence identification Wolbachia Wolbachia strain wMelPop coding Retrieved from Effector for population wMelPop sequence wMelPop strain suppression Derived from D. Drives expression in melanogaster mosquito eyes Derived from Aedes Drives expression in aegypti mosquito cells 3XP3 enhancer Hsp70 promoter Eye-specific enhancer Heat shock protein 70 promoter PhiC31 integrase Recognition site for PhiC31 integrase Synthetic DNA attB site for site-specific integration sequence AttB site for integration FASTA Peptide Sequences ECFP >ECFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTGAGCAA GGGCGAGG Wolbachia wMelPop >Wolbachia_wMelPop ATGATGAACGAAGAAGAAAAATCAACAGTATCTTTATTAGAGTTTCGAGTACGAGC GTTCATC PhiC31 integrase >PhiC31_integrase 15 ATGACGAACACCCCGGCACCGGAGGTGCTACCTGGAAGGCGCTGCAGGCATTCGGG AGCTGAA Bibliography Ata-Abadi, N. S., Forouzanfar, M., Dormiani, K., Varnosfaderani, S. R., Pirjamali, L., NasrEsfahani, M. H., & Hajidavaloo, R. M. (2022). Site-specific integration as an efficient method for production of recombinant human hyaluronidase PH20 in semi-adherent cells. Applied Microbiology and Biotechnology, 106(4), 1459-1473. Calos, M. P. (2016). Phage integrases for genome editing. Genome Editing: The Next Step in Gene Therapy, 81-91. Fani Maleki, A., & Sekhavati, M. H. (2018). Application of phiC31 integrase system in stem cells biology and technology: a review. Frontiers in Life Science, 11(1), 1-10. Guha, T. K., & Calos, M. P. (2020). Nucleofection of phiC31 integrase protein mediates sequence-specific genomic integration in human cells. Journal of molecular biology, 432(13), 3950-3955. Knapp, J. M., Chung, P., & Simpson, J. H. (2015). Generating customized transgene landing sites and multi-transgene arrays in Drosophila using phiC31 integrase. Genetics, 199(4), 919-934.

Collepals.com Plagiarism Free Papers

Are you looking for custom essay writing service or even dissertation writing services? Just request for our write my paper service, and we'll match you with the best essay writer in your subject! With an exceptional team of professional academic experts in a wide range of subjects, we can guarantee you an unrivaled quality of custom-written papers.

Get ZERO PLAGIARISM, HUMAN WRITTEN ESSAYS

Why Hire Collepals.com writers to do your paper?

Quality- We are experienced and have access to ample research materials.

We write plagiarism Free Content

Confidential- We never share or sell your personal information to third parties.

Support-Chat with us today! We are always waiting to answer all your questions.